pgem-t easy a1360 Search Results


pgem-t easy vector system  (Promega)
90
Promega pgem-t easy vector system
Pgem T Easy Vector System, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgem-t+easy+a1360/pmc03039753-50-10-9?v=Promega
Average 90 stars, based on 1 article reviews
pgem-t easy vector system - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
pgem-t easy vector  (Promega)
90
Promega pgem-t easy vector
Pgem T Easy Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgem-t+easy+a1360/us07193071-241-249-254?v=Promega
Average 90 stars, based on 1 article reviews
pgem-t easy vector - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
dnase set qiagen 79254 pgem t easy vector system promega a1360 deposited data pigeon whole genome sequencing  (Qiagen)
99
Qiagen dnase set qiagen 79254 pgem t easy vector system promega a1360 deposited data pigeon whole genome sequencing
KEY RESOURCES TABLE
Dnase Set Qiagen 79254 Pgem T Easy Vector System Promega A1360 Deposited Data Pigeon Whole Genome Sequencing, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgem-t+easy+a1360/pmc08612976-587-26-28?v=Qiagen
Average 99 stars, based on 1 article reviews
dnase set qiagen 79254 pgem t easy vector system promega a1360 deposited data pigeon whole genome sequencing - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier
wizard sv gel and pcr clean-up system  (Promega)
90
Promega wizard sv gel and pcr clean-up system
KEY RESOURCES TABLE
Wizard Sv Gel And Pcr Clean Up System, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgem-t+easy+a1360/pm28575656-195-178-181?v=Promega
Average 90 stars, based on 1 article reviews
wizard sv gel and pcr clean-up system - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
jm109 competent cells  (Promega)
90
Promega jm109 competent cells
KEY RESOURCES TABLE
Jm109 Competent Cells, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgem-t+easy+a1360/10__1016_slash_j__jcs__2020__103135-171-15-24?v=Promega
Average 90 stars, based on 1 article reviews
jm109 competent cells - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
homo sapiens actb cdna cloned pgem-t easy vector  (Promega)
90
Promega homo sapiens actb cdna cloned pgem-t easy vector
KEY RESOURCES TABLE
Homo Sapiens Actb Cdna Cloned Pgem T Easy Vector, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgem-t+easy+a1360/pmc08157312-1320-7-12?v=Promega
Average 90 stars, based on 1 article reviews
homo sapiens actb cdna cloned pgem-t easy vector - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
rnase a  (Promega)
90
Promega rnase a
KEY RESOURCES TABLE
Rnase A, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgem-t+easy+a1360/pm30954402-289-2-7?v=Promega
Average 90 stars, based on 1 article reviews
rnase a - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
plasmid pgem t-easy  (Promega)
90
Promega plasmid pgem t-easy

Plasmid Pgem T Easy, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgem-t+easy+a1360/pmc07670262-62-0-4?v=Promega
Average 90 stars, based on 1 article reviews
plasmid pgem t-easy - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
pgemt-pthlha plasmid  (Promega)
90
Promega pgemt-pthlha plasmid

Pgemt Pthlha Plasmid, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgem-t+easy+a1360/pm34919126-255-14-6?v=Promega
Average 90 stars, based on 1 article reviews
pgemt-pthlha plasmid - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier
ligation  (Addgene inc)
93
Addgene inc ligation

Ligation, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgem-t+easy+a1360/pmc08691842-177-26-27?v=Addgene+inc
Average 93 stars, based on 1 article reviews
ligation - by Bioz Stars, 2026-08
93/100 stars
  Buy from Supplier
qscript cdna synthesis kit  (Quanta Biosciences)
97
Quanta Biosciences qscript cdna synthesis kit

Qscript Cdna Synthesis Kit, supplied by Quanta Biosciences, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgem-t+easy+a1360/custom%4095047-025%4032402284?v=Quanta+Biosciences
Average 97 stars, based on 1 article reviews
qscript cdna synthesis kit - by Bioz Stars, 2026-08
97/100 stars
  Buy from Supplier
recombinant dna reagent  (Promega)
90
Promega recombinant dna reagent

Recombinant Dna Reagent, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pgem-t+easy+a1360/pmc06548507-21-0-8?v=Promega
Average 90 stars, based on 1 article reviews
recombinant dna reagent - by Bioz Stars, 2026-08
90/100 stars
  Buy from Supplier

Image Search Results


KEY RESOURCES TABLE

Journal: Current biology : CB

Article Title: A ROR2 coding variant is associated with craniofacial variation in domestic pigeons

doi: 10.1016/j.cub.2021.08.068

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: ​ REAGENT or RESOURCE SOURCE IDENTIFIER Critical Commercial Assays DNeasy Blood and Tissue Kit Qiagen 69504 RNAlater ThermoFisher Scientific AM7021 RNeasy Mini Kit Qiagen 74004 RNase-Free DNAse Set Qiagen 79254 pGEM-T Easy Vector System Promega A1360 Deposited Data Pigeon whole genome sequencing and pigeon embryonic craniofacial RNA-sequencing datasets NCBI SRA database PRJNA680754, PRJNA513877 Vertebrate ROR2 and invertebrate ROR homolog amino acid sequences Ensembl ( ensembl.org ) and NCBI ( ncbi.nlm.nih.gov/gene ) Experimental Models: Organisms/Strains Columba livia Shapiro Lab loft, Utah Pigeon Club, various pigeon breeders Oligonucleotides ROR2-forward GGAACCGACAGGTTCTACCA ROR2-reverse TGCTTCGTCCATCTGAAGTG WNT5A-forward CATAGTGGCTCTGGCCATTT WNT5A-reverse CCCCGACTGTTGAGTTTCAT Software and Algorithms ImageJ v1.52q https://imagej.nih.gov/ij/ Amira v6.5.0 ThermoFisher Scientific i3D Converter v3.80 IDAV Landmark Editor v3.0 UC Davis FastQC Babraham Bioinformatics Cutadapt [ 54 ] Bowtie2 [ 56 ] Stacks v2.52 [ 57 ][ 58 ] R/qtl v1.46-2 [ 67 ] msa v1.18.0 [ 61 ] geomorph v3.3.1 [ 63 ][ 64 ][ 65 ] R v3.6.3 [ 66 ] Morpho v2.8 https://github.com/zarquon42b/Morpho ggplot2 v3.3.0 [ 53 ] gggenes v0.4.0 https://github.com/wilkox/gggenes FastQForward [ 68 ] VCFLIB GPAT++ toolkit github.com/vcflib VAAST2 [ 36 ] STAR v2.5.0a [ 74 ] Subread featureCounts v1.5.1 [ 75 ] Salmon v1.5.1 [ 76 ] DESeq2 v1.12.4 [ 77 ] Open in a separate window KEY RESOURCES TABLE

Techniques: Plasmid Preparation, Sequencing, Software

Journal: Cell Host & Microbe

Article Title: A Comprehensive Subcellular Atlas of the Toxoplasma Proteome via hyperLOPIT Provides Spatial Context for Protein Functions

doi: 10.1016/j.chom.2020.09.011

Figure Lengend Snippet:

Article Snippet: Plasmid: pGEM T-Easy , Promega , Cat#A1360.

Techniques: Recombinant, Sequencing, Modification, Protease Inhibitor, Protein Quantitation, Transgenic Assay, Plasmid Preparation, CRISPR, Software

Journal: eLife

Article Title: Species specific differences in use of ANP32 proteins by influenza A virus

doi: 10.7554/eLife.45066

Figure Lengend Snippet:

Article Snippet: Recombinant DNA reagent , pGEM-T Easy vector , Promega , A1360 , .

Techniques: Recombinant, Plasmid Preparation, Bradford Protein Assay, Reporter Assay, Luciferase, Software